Clinical trials
Full profile accessFollow clinical development from study design and recruitment through results.
- Trial phase
- Status
- Readouts
Drug intelligence / Profile preview
aganirsen
- Development stage
- Phase 3
- Lead developer
- Gene Signal
- Modality
- Antisense Oligonucleotides (ASOs) → Long RNA Therapeutics → RNA Therapeutics → Nucleic Acid Therapeutics, Single-strand DNA → Antisense DNA → DNA Therapeutics → Nucleic Acid Therapeutics, Modified DNA Oligonucleotides → Antisense DNA → DNA Therapeutics → Nucleic Acid Therapeutics
- Administration
- Topical, Ophthalmic
01
Overview
Aganirsen is a 25-mer DNA antisense oligonucleotide therapeutic that inhibits the expression of insulin receptor substrate-1 (IRS-1) by binding to its mRNA, thereby blocking protein synthesis. This upstream inhibition reduces neovascularization by decreasing excess VEGF and IL-1β expression. Aganirsen is being developed primarily as a topical treatment (eye drops or emulsion) for ocular neovascularization in diseases such as progressive corneal neovascularization, infectious keratitis, wet age-related macular degeneration, central retinal vein occlusion, diabetic macular edema, and keratoplasty rejection. The drug was originally developed by Gene Signal and has received orphan drug status for several rare eye conditions[1][4][6][8].
- Brand names
- Olisens
- Other names
- TATCCGGAGGGCTCGCCATGCTGCT
02
Targets
Insulin receptor substrate 1 mRNA
Beyond the preview
Go deeper on aganirsen.
Explore the evidence, development activity, and competitive landscape with Gosset’s full data platform.
Indications & development
Full profile accessExplore development by indication, patient population, and geography.
- Indications
- Development status
- Countries
Licensing & deals
Full profile accessTrace asset ownership, licensing agreements, and commercial partnerships.
- Partners
- Deal terms
- Milestones
Patents & exclusivity
Full profile accessExplore the patent landscape and regulatory exclusivity around an asset.
- Patents
- Expiration dates
- Exclusivity
Competitive landscape
Full profile accessCompare development programs by target, modality, and indication.
- Competing assets
- Targets
- Development stage
Research & analysis
Full profile accessConnect source evidence and development news to your research questions.
- Publications
- News
- Analysis
Bring the full picture into focus.
See how Gosset can support your research on aganirsen.