Clinical trials
Full profile accessFollow clinical development from study design and recruitment through results.
- Trial phase
- Status
- Readouts
Drug intelligence / Profile preview
aprinocarsen
- Development stage
- Phase 3
- Lead developer
- Eli Lilly
- Modality
- Antisense Oligonucleotides (ASOs) → Long RNA Therapeutics → RNA Therapeutics → Nucleic Acid Therapeutics, Modified DNA Oligonucleotides → Antisense DNA → DNA Therapeutics → Nucleic Acid Therapeutics, Single-strand DNA → Antisense DNA → DNA Therapeutics → Nucleic Acid Therapeutics
- Administration
- Intravenous
01
Overview
Aprinocarsen is a synthetic phosphorothioate oligodeoxynucleotide that functions as an antisense molecule. It specifically inhibits the expression of protein kinase C-alpha (PKC-α) by hybridizing to its 3'-untranslated region mRNA, leading to RNase H-mediated cleavage of the hybridized mRNA and reduced PKC-α protein levels. This mechanism regulates cell differentiation and proliferation, demonstrating anti-tumor activity in various human tumor cell lines in preclinical models. It was initially developed by Isis Pharmaceuticals (now Ionis Pharmaceuticals) and later licensed to Eli Lilly & Co. for the treatment of human cancers.
- Brand names
- AffinitakAffinitac
- Other names
- Aprinocarsen sodiumDNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) protein kinase C-alpha antisense
02
Targets
PRKCA (Protein kinase C alpha)
Beyond the preview
Go deeper on aprinocarsen.
Explore the evidence, development activity, and competitive landscape with Gosset’s full data platform.
Indications & development
Full profile accessExplore development by indication, patient population, and geography.
- Indications
- Development status
- Countries
Licensing & deals
Full profile accessTrace asset ownership, licensing agreements, and commercial partnerships.
- Partners
- Deal terms
- Milestones
Patents & exclusivity
Full profile accessExplore the patent landscape and regulatory exclusivity around an asset.
- Patents
- Expiration dates
- Exclusivity
Competitive landscape
Full profile accessCompare development programs by target, modality, and indication.
- Competing assets
- Targets
- Development stage
Research & analysis
Full profile accessConnect source evidence and development news to your research questions.
- Publications
- News
- Analysis
Bring the full picture into focus.
See how Gosset can support your research on aprinocarsen.