Drug pipeline
Full profile accessExplore the programs pursuing this target and their development progress.
- Drug candidates
- Developers
- Development stage
Target intelligence / Profile preview
MicroRNA 6791-5p (hsa-miR-6791-5p)
- Target
- hsa-miR-6791-5p
- Molecular classification
- microRNA, non-coding RNA, regulatory RNA
01
Overview
MicroRNA 6791-5p (hsa-miR-6791-5p) is a small, endogenous non-coding RNA (20–24 nucleotides), involved in fine-tuning gene expression by base-pairing with target mRNAs to inhibit translation or promote degradation. Its sequence is “CCCCUGGGGCUGGGCAGGCGGA,” and it is experimentally validated in databases. Aberrant expression or dysregulation of microRNAs, including hsa-miR-6791-5p, has been implicated in multiple cancers and metabolic diseases, often detected via expression profiling. Research reagents such as mimics and agomirs are used in laboratory studies to modify its activity, but it is not a classical drug target and no approved therapeutics target this molecule directly
- Other names
- MIR6791hsa-miR-6791-5pmiR-6791-5p
02
Mechanism of action
Not drug-targeted; however, miRNA mimics or inhibitors function by upregulating or downregulating gene expression through mRNA interaction
03
Biological functions
Post-transcriptional regulation of gene expressionRegulation of cell growth, differentiation, and apoptosis via mRNA targeting
04
Disease associations
Cancer (differential expression observed in cancer cells, including hepatocellular carcinoma and associations with disease databases)Potential links to metabolic disease (e.g., type 2 diabetes)Listed in esophageal cancer detection patent
05
Safety considerations
Not directly applicable; safety concerns would pertain to experimental manipulation (off-target effects, delivery challenges with synthetic mimics/inhibitors)
06
Biomarkers
Differential miRNA expression can be used as a biomarker in cancer and metabolic disease research (shown in cancer studies, diabetes, and esophageal cancer detection kits)
Beyond the preview
Go deeper on MicroRNA 6791-5p (hsa-miR-6791-5p).
Explore the evidence, development activity, and competitive landscape with Gosset’s full data platform.
Clinical trials
Full profile accessFollow the clinical studies evaluating therapies directed at this target.
- Trial design
- Status
- Readouts
Competitive landscape
Full profile accessCompare approaches across drug candidates, modalities, and indications.
- Programs
- Modalities
- Indications
Literature & evidence
Full profile accessInvestigate the research and source evidence behind target biology and development.
- Publications
- Sources
- Analysis
Patents
Full profile accessExplore patent activity around therapies and technologies addressing this target.
- Patents
- Assignees
- Technologies
Research & analysis
Full profile accessConnect target biology, drug development, and emerging evidence in your research.
- Biology
- Development news
- Analysis
Bring the full picture into focus.
See how Gosset can support your research on MicroRNA 6791-5p (hsa-miR-6791-5p).